Experimental Scheme Sharing: Qualitative Real-time Polymerase Chain Reaction (PCR) Detection for Monkeypox Virus (Monkeypox virus, MPXV)

DSPath 4X One-Step Multiplex Master Mix Experimental Protocol 1

Qualitative Real-time Polymerase Chain Reaction (PCR) Detection for Monkeypox Virus (Monkeypox virus, MPXV):

1. Research Background and Objectives

   - The Monkeypox virus (MPXV) is a member of the Orthopoxvirus (OPXV) genus and has become the most severe disease caused by OPXV since the eradication of smallpox.

   - The outbreak of the global monkeypox epidemic in 2022 has prompted the need to increase the diagnostic capacity of clinical testing.

   - The purpose of the study is to validate a qualitative OPXV real-time PCR detection method and describe its analytical performance in the clinical laboratory diagnosis of MPXV.

2. Materials and Methods

   2.1 Materials for Analytical Performance Experiments

   - Experiments are conducted using Universal Transport Medium (UTM) or Viral Transport Medium (VTM) containing synthetic MPXV DNA.

   2.2 DNA Extraction

   - Automated nucleic acid extraction is performed using a nucleic acid extraction instrument.

   2.3 Real-time TaqMan PCR Detection

   - Total reaction volume: 20 µL (including 5 µL of template and 15 µL of master mix).

   - Components of the master mix:

     - 5 µL DSPath 4X One-Step Multiplex Master Mix (GDSBio, V5005).

     - 7 µL dH2O.

     - 1 µL forward primer (10 nm).

     - 1 µL reverse primer (10 nm).

     - 1 µL probe (5 nm), targeting the OPXV target sequence.

   - Clinical sample testing: When an internal control is added, the volume of dH2O is reduced to 4 µL to allow for the addition of 1 µL each of the forward and reverse primers (10 nm) and probe (5 nm), targeting the human RNAseP gene.

   - Real-time PCR operation: The Prism 7500 Sequence Detection System (Applied Biosystems) is used, and the following cycling conditions are applied:

     - 1 cycle: 95.0°C for 2 minutes.

     - 40 cycles: 95.0°C for 3 seconds, 60.0°C for 31 seconds.

In this experiment, real-time PCR is used to detect and quantify the Monkeypox virus DNA. The TaqMan chemistry method used is a common fluorescent quantitative PCR technique that can monitor the accumulation of DNA in real-time during the PCR amplification process. In this way, the concentration of the virus DNA can be accurately determined, which helps in diagnosing Monkeypox virus infections.

The following are the primer and probe sequences used in the experiment:

1. Primer and probe sequences for the OPXV target:

   - Forward primer (F): `TCAACTGAAAAGGCCATCTATGA`

   - Reverse primer (R): `GAGTATAGAGCACTATTTCTAAATCCCA`

   - Probe (P): `FAM-CCATGCAATATACGTACAAGATAGTAGCCAAC`

2. Primer and probe sequences for the internal control human RNAseP gene:

   - Forward primer (F): `AGATTTGGACCTGCGAGCG`

   - Reverse primer (R): `GAGCGGCTGTCTCCACAAGT`

   - Probe (P): `Cy5–TTCTGACCTGAAGGCTCTGCGCG`

3. Positive patient samples from the first month of testing were also tested in-house with a research-based Monkeypox-specific PCR using the following primer and probe sequences (targeting the B6R gene):

   - Forward primer (F): `ATTGGTCATTATTTTTGTCACAGGAACA`

   - Reverse primer (R): `AATGGCGTTGACAATTATGGGTG`

   - Probe (P): `FAM-AGAGATTAGAAATA`

2.4 Limit of Detection (LOD)

- The LOD is determined by diluting MPXV DNA to different concentrations and testing.

2.5 Reproducibility

- Reproducibility is assessed using a positive MPXV sample of 100 copies/mL and negative UTM/VTM.

2.6 Specificity

- Known positive patient samples, including herpes simplex virus type 1 and type 2, are tested to determine specificity.

2.7 Consistency

- A panel of 88 blind samples (including negative and positive samples at different concentrations) is tested.

This experimental protocol describes in detail the entire process from sample collection, nucleic acid extraction, real-time PCR detection to result analysis.

DSPath 4X One-Step Multiplex Master Mix

Product Introduction

The DSPath 4X One-Step Multiplex Master Mix is used to perform one-step multiplex real-time PCR applications with any gene-specific primer and probe sets, and is suitable for both RNA and DNA targets. This master mix is formulated with optimized buffer components to accommodate multiplex amplification of up to four RNA or DNA target sequences in a single reaction. The master mix is supplied at a 4X concentration that allows to input more sample into each reaction, increasing sensitivity even in low-volume reactions.

Application

• Probe gene expression analysis

• Probe Low-copy gene detection

• Probe microarray validation

• Probe gene knockdown validation

Features

• Robust one-step, all-in-one master mix system for easy reaction assembly

• Detect multiple targets in one reaction

• High sensitivity to detect low-copy targets

• Tolerance of inhibitors commonly found in clinical samples

• Eliminates the risk of cross contamination associated with two-step RT-qPCR protocols

Experimental Cases

1. Comparable to first-line brands

Compare with 6 different brands of similar products to detect samples containing the novel coronavirus at low or high concentrations, #V5005 has excellent detection rate and accuracy.

Figure 2. detection of low SARS-CoV-2 sample

Figure 3. detection of high SARS-CoV-2 sample

Stable performance

DSPath 4X One-Step Multiplex Master Mix is very stable, and you can get the benefit from high stability: keep the master mix in the refrigerator for up to 4 weeks and profit from a quick setup without thawing first.

The stability test of DSPath 4X One-Step Multiplex Master Mix/MixB/MixC/MixD was performed at 37°C for 8 days by detecting four targets of SARS-CoV-2. The amplification efficiency of the four products did not change significantly, which means all of them could maintain high stability, and are easy to be transported and stored for a long time.

Figure 4. amplification curve of stability test of DSPath^TM 4X One-Step Multiplex Master Mix/MixB/MixC/MixD

Figure 5. Ct value of stability test of DSPath^TM 4X One-Step Multiplex Master Mix/MixB/MixC/MixD